In most SNP sites, the patterns of SNP distribution among HBV-HCC, alcohol-HCC, and control are very much overlapping each other. The weight for the sequence diversity appears to fall on the 16298T/C and 523A/del two SNPs for HBV-HCC, and 16293G/A, 523A/del, and 525C/del 3 SNPs for alcohol-HCC (Table 3). Several rare alleles defined as being less than 5% of allele frequency, though required selleck screening library confirmation in

a larger population, tend to predict the risk of alcohol-HCC. These SNPs may be of great potentials for future studies of their biological functions. The predictive values of haplotypes, defined by combinations of the M haplogroup status with non-diagnostic but frequent SNPs, for the risks of HBV-HCC and alcohol-HCC are very provocative. The current study provides the evidence that these frequent SNPs nested within selected haplogroup may become useful

predictors for cancer risk. Mutations in the D-Loop region are also frequent in HBV-HCC and the frequency of 21/49 (42.9%, Table 5) is comparable to a report (39.3%) Rapamycin solubility dmso from another Chinese population [25]. The alcohol-HCC group appears to have a similarly high mutation frequency (4/11, 36.4%). The 309C/ins or 309C/del is still the most common type of mutation, as seen by others in many types of tumors [20, 27]. Seventeen of the 60 HCC patients harbored somatic deletions/insertions at this mononucleotide repeat. The 309 repeat is part of the CSBII, which contributes to the formation of a persistent RNA-DNA hybrid to initiate the mtDNA replication [20, 29, 30], Some severe alteration in this repeat could lead to functional impairment of mitochondria and promote a growth advantage for tumor cell. Base changes persistent from adjacent noncancerous to cancerous areas in 4 of 21 HBV-HCC and 1 of 4 alcohol-HCC patients with mutations suggest that sequence alteration may occur early and may play a role in tumorigenesis. Mutation in adjacent non-tumor tissue with

normal morphology, also observed by others [17, 19], does not appear to be an incidental finding. Although the mechanism of mutation is still unclear, free radicals generated in mitochondria could be responsible at least partly for these mutations. The D-loop region of mtDNA is important for cAMP regulation of mitochondrial genome replication and expression. Mutation in this region may affect mtDNA replication and may alter electron transport chain. All of these might contribute to early stage of hepatocarcinogenesis. Our data demonstrated that the utility of SNPs and mutations in mitochondria D-Loop region to predict HCC risk and to differentiate HCCs with distinct etiology. The utility of mtDNA SNPs for prediction of HCC risks from different environmental exposures is a promising area for future cancer prevention.

Even if this were not true, light coupling into the slit and propagation though it would make the field behind the exit plane of the probe virtually symmetric about the z axis. Therefore, also the field amplitude distributions in the focal region are virtually independent

on the position of the incident field; only the measured intensity changes and therefore allows the profiling of Anti-infection Compound Library the incident field without moving the detector. Figure 9a shows a comparison of the magnetic intensity profile |H y |2 of the incident field and the result of simulated measurement through the probe under conditions that approximate our experimental setup. For the convenience of resolution judgment, the peak values of both profiles have been normalized to unity, and the profiles are identical almost within the plotting precision. The simulated measured profile is slightly wider than the true incident field owing to the finite width of the slit. A normalized plot of simulated measurement without the corrugations in the probe gives a profile indistinguishable from the red curve in Figure 9a. However, the advantage of having the corrugations is obvious from Figure 9b. Here, we compare the peak values of the measured signal with and without the corrugations as a function of the numerical aperture of the collection optics. Without

the corrugations, the beaming effect disappears, and hence, the sensitivity gain for small numerical apertures PtdIns(3,4)P2 is RG7204 price as high as 3 to 4. At NA=1.4, which corresponds to our experimental setup, the theoretical gain factor is still approximately 1.5. Figure 9 Simulated transmittance. (a) Magnetic field intensity of the incident beam at the entrance plane of the probe (black line) and the simulated measurement result (red line), normalized to have a unit peak value. (b) Dependence of

the sensitivity gain factor achieved by having the corrugations in the probe, plotted as a function of the collection NA. Scanning electron micrographs of the device taken during the fabrication process are presented in Figure 10a and in the inset Figure 10b, where the grating-glue interface and the slit in the aluminum film are shown, respectively. In Figure 10a, the glue was partially peeled off from the Al layer (on the bottom of the figure) due to cutting of the structure for cross-sectional imaging, but high-accuracy penetration into the grooves is visible from the modulation. The slit shown in Figure 10b is not etched completely through; hence, a longer etch time was used to fabricate the final probe. The inset of Figure 10c shows the AFM image of the top surface without the TiO2 layer to illustrate the high-quality metal surface obtained by the template stripping process.

The importance of neutrophils in defending Pseudomonas infection high throughput screening is reflected by significant

increase in infection rate in neutropenic patients [4]. Winterbourn and colleagues modeled the reactions of oxidant production in neutrophil phagosomes. They calculated that superoxide is produced at a rate of ~312 mM/min and HOCl 134 mM per minute [10]. In this current study, the maximal concentration of H2O2 used was 5 mM and HOCl 0.07 mM. A recent report documented that bleaching of GFP expressed in SA is seen at concentrations of 0.05-0.1 mM HOCl which correlated well with killing of SA by this oxidant [26], suggesting that similar concentrations of HOCl were likely achieved in vivo. The mathematical model proposed by Winterbourn and colleagues predicts that such levels can be reached within seconds after activation of the NADPH oxidase [10]. Thus, we believe that the selected concentrations of H2O2 and HOCl in our studies are well within the scope of the achievable oxidant levels in neutrophils. Precise

mechanisms of oxidant-mediated bacterial killing are not fully defined. Early studies using EC as a model organism indicated a correlation between EC envelope permeabilization and bacterial inactivation by HOCl; however, only low-molecular weight compounds became freely permeable while the cell maintained its SB431542 barrier function to proteins [27]. Albrich et al. (1986) tested the small-molecule permeability theory in EC by measuring the transport of H+ ion and glycerol and reported that the intercellular movements of these molecules were only marginally affected [28]. Their conclusion was that HOCI inactivation of bacteria does not occur by loss of membrane structural

integrity, which contradicts the previous report. In the current study, we demonstrated that membrane integrity is affected by H2O2 and HOCl, but the effect is organism-specific (Figures 2 and 3). Statistically, permeability of BC and EC caused by H2O2 and HOCl did correlate with loss of viability while permeability of KP with only H2O2 exposure correlated with loss of viability. It is notable that permeability Verteporfin nmr and CFU viability were statistically independent of each other for PsA and SA, the two most prevalent CF pathogens, in both H2O2 and HOCl exposures. EC and PsA have been shown to recover from reduced adenylate energy charge, when subsequently supplied with nutrients which facilitate ATP hydrolase activity of the F1F0 complex of the bacterial ATP synthase [29]. After treatment with bactericidal doses of HOCl, however, adenylate energy charge is unrecoverable and further ATP production is abolished [17]. These findings suggest that a potent oxidant-induced killing mechanism may cause destruction of ATP production by specific oxidation of the F1F0 ATP synthase [30].

Figure 4 Rapamycin sensitizes T-ALL cells to GC treatment by enhancing apoptotic cell death. (A) T-ALL cells were incubated for 24~72 h (according to different time points to early stage of apoptosis) with rapamycin(10 nM) and/or Dex (1 μM), and the early stage of apoptosis were detected by Annexin V-FITC/PI staining. For all experiments, values of triple experiments were shown as mean plus or minus SD. * p < 0.05 as compared with control group or Dex group or Rap group (except for Jurkat cells at 48 h). (B) After 48 h exposure to rapamycin Venetoclax and/or Dex, Molt-4 cells were lysed and extracts were analyzed by Western blotting for GR expression. The ability to up-regulate

glucocorticoid receptor (GR) expression upon GC exposure has been demonstrated in various cell lines of lymphoid leukemias and this up-regulation of GR has been suggested as an essential step to the induction of apoptosis in leukemic cells [24]. In Molt-4 cells, we found no change of GR expression after treatment with rapamycin or Dex singly or in combination (Figure 4B). So up-regulation of

GR expression might not participate in the mechanism of rapamycin’s reversion of GC resistance in GC-resistant T-ALLs. In the same cells, we found that although caspase-3 was not activated by rapamycin or Dex alone, but a strong activation was ensued after combined treatment (Figure 4B), suggesting that apoptosis mechanism did involve in the process. We then examined the expressions of Bcl-2, Bax, Bim-EL, and Mcl-1 in Molt-4 cells. Selleck PD-L1 inhibitor Similar to other study [12], levels of the anti-apoptotic protein Bcl-2 was unchanged after exposure to rapamycin or Dex alone or in combination, whereas Mcl-1 level was reduced significantly after exposure to rapamycin alone Unoprostone or in combination with Dex, but not modulated by Dex alone. Both Dex and rapamycin induced expression of Bim-EL and Bax significantly and there was a synergistic effect when they were used together (Figure 5). These data further support that rapamycin reverses GC resistance via activation of

the intrinsic apoptotic program. Figure 5 Western blot analysis of the apoptosis associated proteins in Molt-4 cells after 48 h exposure to rapamycin and/or Dex. R, rapamycin; D, Dex; RD, rapamycin+ Dex; and C, control. Disccusion In vivo response to 7 days of monotherapy with prednisone is a strong and independent prognostic factor in childhood ALL [25]. Despite intensive research efforts, GC resistance remains a major obstacle to successful T-ALL treatment. Increasing evidences now indicate that rapamycin, the mTOR inhibitor, could be used as a potential GC sensitizer [9–13]. In this study, we wanted to explore the possibility of using rapamycin as a therapeutic element in the GC-resistant T-ALLs.

As shown in Figure 1, the normal peritoneum consisted

of only a monolayer of mesothelium cells with little connective tissue and the peritoneum from the patients with early gastric cancer also showed small amounts of connective tissue under the mesothelial cells. In contrast, the peritoneum from patients with carcinomatosis at stage III and IV was substantially thickened and contained extensive fibrosis. Most importantly, the peritoneal fibrosis was also found to occur in the peritonea from stage III gastric cancer in the absence of carcinomatosis. Figure 1 Hematoxylin and eosin and Masson staining of peritoneum tissues. Normal peritoneum and peritoneum from different stages of gastric cancer were obtained PXD101 research buy surgically and subjected Talazoparib mw to H&E and the Masson staining. A, All photos were obtained at 40 × magnification. a and e, The normal peritoneum consists of only a monolayer of mesothelium

with little fibrosis (arrows). b and f, Peritoneum from the patients with early gastric cancer also showed small amounts of connective tissue under the mesothelial cells. In contrast, the peritoneum from patients with carcinomatosis at stage III (c, g) and IV (d, h) was substantially thickened and contained extensive fibrosis (arrows). B, Morphometric parameters of peritoneal tissues. Data are expressed as the mean ± standard error of the mean of at least 3 separate experiments. Detection of TGF-β1 levels in the peritoneal lavage fluid We assayed TGF-β1 protein levels in the peritoneal wash fluid and found that TGF-β1 levels were significantly higher in those patients with gastric cancer than those in the control group.

Levels were even higher in washes from patients with stage III or IV gastric cancer than those with stage I or II (Figure 2). Figure 2 ELISA analysis of TGF-β1 protein levels in peritoneal wash fluid. Samples of the peritoneal wash fluid from patients with benign disease and gastric cancer were obtained and subjected to ELISA analysis. The data were summarized as mean ± standard error of the mean from at least 3 separate experiments. * p < 0.05 as compared with control. Upregulation of Neratinib collagen III and fibronectin expression by TGF-β1 We next determined whether TGF-β1 can affect extracellular matrix production (such as collagen III and fibronectin) in HPMCs. We cultivated and treated them with the recombinant human TGF-β1 and then performed semi-quantitative RT-PCR analysis. Our data showed that TGF-β1 upregulated expression of collagen III and fibronectin mRNA, as compared to the control group (p < 0.05) (Figure 3). Furthermore, Western blot analysis also confirmed this finding at the protein level (Figure 4).

Bioinformatics analysis of B. pseudomallei SDO The B. pseudomallei SDO amino-acid sequence was subjected to basic local alignment search (BLAST) [15]; further alignment was then performed using ClustalW [16]. The sequence with maximum identity, Bacillus megaterium glucose 1-dehydrogenase, was used as a template for homology modeling using SWISS-MODEL [17]. The constructed model was validated

Daporinad nmr by PROCHECK [18]. Construction of B. pseudomallei SDO deletion mutant and complemented strain Deletion mutagenesis of the SDO gene was performed by homologous recombination (Additional file 1), as previously described by Lopez et al. [19]. The B. pseudomallei K96243 SDO gene sequence was obtained from GenBank (accession number NC_ 006351 and locus_tag = “BPSS2242” [14]). Primers used in this study were designed using Primer-BLAST (http://​www.​ncbi.​nlm.​nih.​gov/​tools/​primer-blast). The primer sequences are shown in Table 3. Molecular cloning was carried out on 5′ 298 bp upstream and 3′ 288 bp downstream fragments of the B. pseudomallei SDO gene. The 5′ upstream and 3′ downstream fragments of the SDO gene were ligated find more by PCR using BPSS2242-F1 and BPSS2242-R2; this was facilitated by a tail on the 3′ forward primer to give a new PCR product with

a deletion in the region (631 bp) between BPSS2242-R1 and BPSS2242-F2. Table 3 Oligonucleotide primers used for PCR Primer names Oligo sequences (from 5′–3′) Purpose Reference BPSS2242-F1 ACCGCGCGACCGATATGAACG Forward primer for upstream fragment of SDO gene This study BPSS2242-F2 GGACTCCTTGCCGAACGGGC Reverse primer for upstream fragment of SDO gene This study BPSS2242-R1 GCCCGTTCGGCAAGGAGTCC AACGTCGAGGCGAAGCTGCC Forward primer for downstream fragment of SDO gene

This study BPSS2242-R2 TCCCTTCGCGCTCGTGCAAC buy Atezolizumab Reverse primer for downstream fragment of SDO gene This study OriT-F CAGCCTCGCAGAGCAGGATTC Forward primer for oriT [50] OriT-R TCCGCTGCATAACCCTGCTTC Reverse primer for oriT [50] This constructed fragment was cloned into pGEM®-T Easy Vector and transformed into Escherichia coli strain DH5α. White colonies were selected using β-galactosidase indicator medium, using 50 μg/ml 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) (Promega) plates containing 100 μg/ml ampicillin. Colonies harboring the desired plasmid were analyzed by PCR using primers flanking the mutant allele (BPSS2242-F1 and BPSS2242-R2). Products were checked for correct size by agarose gel electrophoresis and verified by DNA sequencing. The unmarked knockout cassette assembled by PCR containing the deletion of the SDO gene was cloned into the non-replicative plasmid, pEXKm5 [19]. The pEXKm5-mutant allele construct was then transformed into E. coli strain DH5α. Plasmids were extracted and checked by PCR, with primers BPSS2242-F1 and BPSS2242-R2, for correct product sizes of the target gene. The pEXKm5-mutant plasmid was transformed into E.

This indicates that either Crook’s and K-12 lost the T2SSβ-encoding genes independently, or that an ancestor of Crook’s, B, and K-12 lost the genes, which were subsequently re-acquired by strain B. An examination of the T2SSβ-encoding loci in Crook’s and K-12 strongly supports the former explanation. In K-12, the T2SSβ-encoding gsp operon clearly experienced an internal deletion that removed

the gspD-K β genes, inactivating the T2SS. In Crook’s, however, the homologous genomic locus appears entirely different: all gsp genes are absent, and in their place is the fec operon (encoding a ferric citrate transport system) and a variety of putative ORFs. We infer that the most parsimonious explanation of the phylogenetic distribution of T2SSβ

is that K-12 and Crook’s both lost the T2SS at different points in their evolutionary histories. It remains an open question what pattern of gene gains and losses best explains selleck screening library the distribution of T2SSβ across the diversity of E. coli strains not considered in our analysis. It is of interest to note that a non-polar deletion of the pppA gene, encoding a prepilin peptidase, prevents secretion of SslE by E. coli W. This result agrees with a similar experiment performed by Strozen et al. to assess effects of PppA on LT secretion in H10407 [12]. Both W and H10407 also encode a second prepilin peptidase (GspO) whose homolog is functional in facilitating ChiA secretion via T2SSα in K-12 [19]. Whether the GspO peptidase is not expressed under conditions associated with SslE secretion in both W and H10407, or whether the two peptidases display PLX4032 ic50 different substrate specificities, remains to be determined. Strikingly, in the presence of the otherwise intact gsp operon, deletion of sslE was effective in promoting modest urea tolerance. When we first observed the urea-tolerant phenotype of the Δgsp strain, we hypothesized that the mutant’s advantage stemmed from lacking the transmembrane components of the T2SS, particularly the secretin pore in the outer membrane,

which might be denatured by urea. The urea tolerance of the ΔsslE mutant rules out this hypothesis, Thalidomide however, and indicates that secretion of SslE by T2SSβ renders cells modestly more sensitive to urea. Relative urea sensitivity is likely due to indirect effects on cell physiology of bearing surface-displayed SslE or of releasing of SslE into the culture medium. We report here that enzymatic fusions to the C-terminus of SslE interfere with its targeting to the T2SS, as measured by release of fusion proteins and by display of fusion proteins on the outer leaflet of the outer membrane. Previously, Baldi et al. fused a tetracysteine motif to the C-terminus of E2348/69 SslE and saw that the fusion protein was still displayed on the cell surface [9]. We do not think these results contradict ours, due to the significant structural differences between the fusion proteins in question.

P27 THE IMPACT OF HEALTH BELIEFS ON OSTEOPOROSIS TREATMENT Deborah T. Gold, PhD, Duke University Medical School, Durham, NC; Andrew Calderon, BS, Osteoporosis Medical Center, Los Angeles, CA; Stuart L. Silverman, MD, Cedars Sinai, Los Angeles, CA INTRODUCTION The Health Belief Model helps explain which patients are screened, evaluated or treated

for osteoporosis (OP) (Nadler selleck chemicals llc et al., 2013). Furthermore health beliefs may be an important factor in compliance and persistence with OP medications (Schousboe, 2013). Health beliefs include beliefs about OP medication (risks and benefits) and beliefs about medical care (prefer to self treat vs. prefer to take medication). Little empirical research has been done to understand what factors are important in the development of health beliefs of postmenopausal (PM) women making decisions about their bone health. In analyses reported here, we hypothesized that important factors in development of these health beliefs include race/ethnicity, age, education, SES, and history of prior fracture. MATERIAL AND METHODS: As part of a study of racial/ethnic differences in patient Vismodegib cell line preferences for OP medication, we collected information about OP health and treatment beliefs and medication care preferences

in 367 PM women at risk of OP fractures (mean age = 76.7, (SD = 7.1); n = 100 Caucasian, n = 82 Asian, n = 85 Hispanic; n = 100 African Glutamate dehydrogenase American). Health beliefs were measured with the Osteoporosis Health Beliefs Scale (Cadarette et al., 2009) and health care preferences were measured using the Medical Care Preferences Scale (Ganther et al., 2001). The health beliefs scale assesses perceived benefits and risks of OP treatment while the preferences scale measures personal preferences along a continuum anchored by self-treatment on one end versus external care seeking on the other. RESULTS: We found no statistically significant differences in beliefs across race/ethnicity with either the health belief scale or the medical care preference scale. However, both scales revealed statistically significant

differences based on social characteristics including age, with sixth decade women more likely to consider OP treatment (p = 0.039) than older women, and education, where women with less education were more likely to self treat (p = 0.01) and less likely to consider OP medication (p < 0.001) than those with more education. Patients with prior fracture(s) were more likely to consider OP treatment (p = 0.04), but prior fractures had no impact on the medical preferences scale. Individuals with lower SES were more likely to self treat (p < 0.0001) according to the preferences scale; however, SES had no effect on health beliefs about osteoporosis treatment. CONCLUSIONS: The data reported here suggest that health beliefs about OP are influenced by age, SES, education and history of prior fracture, although not by race/ethnicity.

J Bacteriol 1994, 176:3500–3507.PubMed 25. King J, Kocíncová D, Westman Selleckchem Talazoparib E, Lam J: Lipopolysaccharide biosynthesis in Pseudomonas aeruginosa . Innate Immun 2009, 15:261–312.PubMedCrossRef 26. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.

Nucleic Acids Res 1997, 25:3389–3402.PubMedCrossRef 27. Darling ACE, Mau B, Blattner FR, Perna NT: Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res 2004, 14:1394–1403.PubMedCrossRef 28. Jarrell K, Kropinski AM: Identification of the cell wall receptor for bacteriophage E79 in Pseudomonas aeruginosa strain PAO. J Virol 1977, 23:461–466.PubMed 29. Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 1997, 25:955–964.PubMedCrossRef 30. Loessner MJ, LDK378 purchase Inman RB, Lauer P, Calendar R: Complete nucleotide sequence, molecular analysis and genome structure of

bacteriophage A118 of Listeria monocytogenes : implications for phage evolution. Mol Microbiol 2000, 35:324–340.PubMedCrossRef 31. Besemer J, Borodovsky M: Heuristic approach to deriving models for gene finding. Nucleic Acids Res 1999, 27:3911–3920.PubMedCrossRef 32. Wheeler DL, Church DM, Federhen S, Lash AE, Madden TL, Pontius JU, Schuler GD, Schriml LM, Sequeira E, Tatusova TA, Wagner 4-Aminobutyrate aminotransferase L: Database resources of the National Center for Biotechnology. Nucleic Acids Res 2003, 31:28–33.PubMedCrossRef 33. Bragonzi A, Worlitzsch D, Pier GB, Timpert P, Ulrich M, Hentzer M, Andersen JB, Givskov M, Conese M, Doring G: Nonmucoid Pseudomonas aeruginosa expresses alginate in the lungs of patients with cystic fibrosis and in a mouse model. J Infect Dis 2005, 192:410–419.PubMedCrossRef 34. Ohman DE, Chakrabarty AM: Genetic mapping of chromosomal determinants for the production of the exopolysaccharide alginate in a Pseudomonas aeruginosa

cystic fibrosis isolate. Infect Immun 1981, 33:142–148.PubMed 35. Tielen P, Rosenau F, Wilhelm S, Jaeger KE, Flemming HC, Wingender J: Extracellular enzymes affect biofilm formation of mucoid Pseudomonas aeruginosa. Microbiology 2010, 156:2239–2252.PubMedCrossRef 36. Wingender J, Strathmann M, Rode A, Leis A, Flemming HC: Isolation and biochemical characterization of extracellular polymeric substances from Pseudomonas aeruginosa. Meth Enzymol 2001, 336:302–314.PubMedCrossRef 37. Wiehlmann L, Wagner G, Cramer N, Siebert B, Gudowius P, Morales G, Kohler T, van Delden C, Weinel C, Slickers P, Tummler B: Population structure of Pseudomonas aeruginosa . Proc Natl Acad Sci USA 2007, 104:8101–8106.PubMedCrossRef 38. Knezevic P, Kostanjsek R, Obreht D, Petrovic O: Isolation of Pseudomonas aeruginosa specific phages with broad activity spectra. Curr Microbiol 2009, 59:173–180.PubMedCrossRef 39.

Isolation, characterization, and evidence for the existence of complexes with hemagglutinins. The Journal of biological chemistry 1994,269(1):406–411.PubMed 26. Potempa J, Mikolajczyk-Pawlinska J, Brassell D, Nelson D, Thogersen IB, Enghild JJ, Travis J: Comparative properties of two cysteine proteinases (gingipains

R), the products of two related but individual genes of Porphyromonas gingivalis. The Journal of biological chemistry 1998,273(34):21648–21657.CrossRefPubMed 27. Potempa J, Nguyen KA: Purification and characterization of gingipains. Current protocols in protein science/editorial board, John E Coligan [et al] 2007,Chapter 21(Unit 21):20. 28. Potempa J, Pike R, Travis J: Titration Selleckchem MAPK Inhibitor Library and mapping of the active site of cysteine proteinases from Porphyromonas gingivalis (gingipains) using peptidyl chloromethanes. Biol Chem 1997,378(3–4):223–230.CrossRefPubMed 29. Kinane DF, Shiba H, Stathopoulou PG, Zhao H, CP-673451 cell line Lappin DF, Singh A, Eskan MA, Beckers S, Waigel S, Alpert B, et al.: Gingival epithelial cells heterozygous for Toll-like receptor 4 polymorphisms Asp299Gly and Thr399ile are hypo-responsive to Porphyromonas gingivalis. Genes and immunity 2006,7(3):190–200.CrossRefPubMed Competing interests The authors declare that they have no competing interests. Authors’ contributions

DFK, JCG and PGS designed the study and drafted the manuscript. PGS carried out majority of the experiments. JCG carried out the apoptosis assays. MRB designed the PCR array experiments and helped in drafting the manuscript. CAG carried out the flow cytometry experiments. JP provided critical comments to improve the manuscript. All authors were involved in analyzing all the data, read and approved the final manuscript.”
“Background Geobacter metallireducens is a member of the Geobacteraceae, a family of Fe(III)-respiring Delta-proteobacteria

that are of interest for their role in cycling of carbon and metals in aquatic sediments and subsurface environments Etomidate as well as the bioremediation of organic- and metal-contaminated groundwater and the harvesting of electricity from complex organic matter [1, 2]. G. metallireducens is of particular interest because it was the first microorganism found to be capable of a number of novel anaerobic processes including: (1) conservation of energy to support growth from the oxidation of organic compounds coupled to the reduction of Fe(III) or Mn(IV) [3, 4]; (2) conversion of Fe(III) oxide to ultrafine-grained magnetite [3]; (3) anaerobic oxidation of an aromatic hydrocarbon [5, 6]; (4) reduction of U(VI) [7]; (5) use of humic substances as an electron acceptor [8]; (6) chemotaxis toward metals [9]; (7) complete oxidation of organic compounds to carbon dioxide with an electrode serving as the sole electron acceptor ([10]; and (8) use of a poised electrode as a direct electron donor [11].