HIV-1 Integrase Diversity and Resistance-Associated Mutations and Polymorphisms among Integrase strand transfer Inhibitor-Naïve HIV-1 Patients from Cameroon

Sello Given Mikasi, Josiah Otwoma Gichana, Cheri van der Walt, Dominik Brado Adetayo Emmanuel Obasa, Duncan Njenda, Martha Messembe, Emilia Lyonga, Okomo Assoumou, 6Ruben Cloete, 5George Mondinde Ikomey, 1Graeme Brendon Jacobs.

Abstract

The World Health Organization (WHO) has put forth recommendations for the use of Integrase (IN) strand transfers inhibitors (INSTIs) to be part of the first-line combination antiretroviral therapy (cART) regimen to treat HIV infections. The knowledge of pretreatment drug resistance against INSTIs is still scarce in resource-limited settings. We characterised the integrase gene to identify resistance-associated mutations (RAMs) in 56 INSTI-naïve patient viral sequences from Cameroon. Study analysis used 37 sequences with fragment size ≥ 500bp or of good quality .The majority of the sequences were identified as CRF02_AG 54.% (n=20/37) and 45.9 % (n=17/37), other subtypes viral sequences includes (A, CRF36_cpx, F ,G and C). 18.9 % (n=7/37) of the sequences had RAMs, with only 5.4% (n=2/37) having major RAMs (Y143R/C/D/G and P145S), against INSTIs. Accessory RAMs were present in 8.1 % (n=3/37) of sequences, of which one sequence contained solely E157Q, another Q95K. One patient sequence had three accessory RAMs (G140E, E157Q, and G163R). We identified major RAMs to INSTIs, which might have a potential clinical impact to dolutegravir (DTG) roll out in resource-limited settings (RLS) including Cameroon. This is the first study to describe RAMs among INSTI naïve people living with HIV-1 (PLHIV-1) infected with CRF02_AG and other subtypes in Cameroon.

Keyword: HIV-1, Integrase, Resistance, Cameroon, Diversity, CRF02_AG

Summary

Integrase (IN) strand transfer inhibitors (INSTIs) are the newest class of drugs used as combination antiretroviral therapy (cART) for the treatment of HIV-1 infections. These drugs are clinically effective against HIV-1 strains that had previously exhibited resistanceassociated mutations (RAMs) against other cART drugs1. IN consists of three functional domains: The N-terminal domain (amino acids 1-50), which coordinates zinc-binding, the catalytic core domain (amino acids 51-212) and the C-terminal domain (amino acids 213288), which facilitate the host binding and Integrase oligomerization2. Most studies that focus on HIV-1 IN resistance, protein structure and drug binding involve HIV-1 subtype B (HIV-1B) which represents less than 10% of the total worldwide pandemic. In contrast, HIV-1 non B subtypes dominate the pandemic with the majority of subtypes circulating in sub-Saharan Africa. Sub-Saharan Africa is home to more than 90% of people living with HIV-1 (PLHIV-1). 3
Cameroon and the surrounding areas are seen as the “birth-place” of HIV and CRF02-AG is the most common and highly prevalent variant in the region. HIV-1 CRF02_AG is also becoming frequent in developed countries, such as France and Brazil 4. Studies have shown that INSTIs are clinically effective against HIV-1B strains. There is a lack of data concerning the efficacy of these inhibitors on HIV-1 non-B subtype strains. Naturally occurring polymorphisms (NOPs) can have impact on INSTIs susceptibility / resistance in non-B subtypes5. We evaluated the genetic diversity and NOPs of HIV-1 IN sequences from INSTIs naïve patients from Yaoundé, Cameroon. This is the first study to investigate the prevalence of dolutegravir (DTG) RAMs in people living with HIV-1 (PLHIV-1) from Yaoundé, Cameroon.
We obtained blood plasma samples (n = 56) from INSTI treatment naïve PLHIV-1. Our cohort consisted of patient samples from multiple ethnic groups, different age groups as well as different sexual orientations. Patients were sampled between January 2016 and December 2017, and were stored until 2019. Ethical permission for this study was obtained from the Health Research Ethics Committee of Stellenbosch University (N14/10/130 and N15/08/071). The laboratory experiments were conducted according to the ethical guidelines and principles of the international Declaration of Helsinki 2013, South African Guidelines for Good Clinical Practice and the Medical Research Council (MRC) Ethical Guidelines for Research.
Viral RNA was extracted from the 56 patient plasma samples, using the QIAamp Viral RNA Mini Extraction Kit (Qiagen, Germany), according to the manufacturer’s instructions and stored at −80°C un l used. The synthesis of complementary DNA (cDNA) and first-round PCR amplification was performed using the Invitrogen SuperScript® III Reverse Transcriptase (RT) reagents (Invitrogen, Germany), as per the manufacturer’s instructions. In-house amplification of the IN region (867 bp, positions 4230–5096, HXB2 strain) by nested RT-PCR was carried out as previously described by our laboratory 6, 7. Purified amplicons were sequenced on both strands with conventional Sanger DNA sequencing, using the ABI Prism Big Dye® Terminator sequencing kit version 3.1 and run on the ABI 3130xl automated DNA sequencer (Applied Biosystems, USA), according to manufactures instructions. Primers spanning the full-length integrase (867 bp) were used to sequence the PCR products in both directions. These include sequencing primers consist of the above primers, Poli6 and Poli7 and additional sequencing primers were used namely; Poli2 (TAAARACARYAGTACWAATGGCA), relative to position 4745–4766 and KLVO83 (GAATACTGCCATTTGTACTGCTG), corresponding to position 4750– 4772.
IN sequence, data were assembled and manually edited using sequencer version 6.0 (Genecodes, ANN Arbor, USA). Viral sequences were also subtyped using the Rega algorithm (http://hivdb.stanford.edu).
Multiple sequence alignment of the full IN region, with reference sequences from HIV-1 subtypes (A-K) and recombinants viruses which are prevalent in Cameroon, were obtained from the Los Alamos National Library database (www.lanl.gov), were performed by MAFFT version7.0. Aligned sequences were manually edited using the BioEdit software package8 and subsequently used in phylogenetic analysis. A maximum likelihood (ML) tree was constructed using Mega version 7.0, with the Kimura 2 parameter. Bootstrapping was performed with 1000 replicates, with significant values of > 70% indicated on the tree. One reference sequence belonging to the phylogenetic groups O was used as an outgroup. Nucleotides sequences were converted to amino acid and compared to the 2004 consensus C sequences available from the HIV Los Alamos National Library database (hivlanl). The amino acid sequence alignment was extensively screened for the presence of primary and secondary RAMs and NOPs associated with resistance to known INSTIs. Furthermore, the Fisher exact test was used to compare amino acid frequencies across all IN codons, in INSTI-naive versus raltegravir (RAL) -experienced sequences available from the Stanford HIV drug resistance database (http://hivdb.stanford) and to check NOPs that are significantly enriched for INSTI RAMs in subtype CRF02_AG HIV-1.
Multiple sequences that were ≤ 500bp or of low quality were excluded from further subtyping analysis. We used 37 sequences for phylogenetic inference and identified 54.1% (20/37) of the samples as HIV-1 subtype CRF02_AG, followed by 18.1% (9/37) as subtype A, 8.1% (3/37) as subtype CRF36_cpx, 8.1 % (3/37) as subtype F, 5.4% (2/37) as subtype G and 5.4% (2/37) as HIV-1 subtype C strains (Fig.1). The nucleotide sequence of the IN gene was available for 37 plasma samples. These were subsequently screened for the presence of RAMs and identified 18.9% (7/37) sequences to contain RAMs, with 5.4% (2/37) having major INSTI RAMs: P145S (Baby44IN) and Y143R/C/D/G), were present in one sequence each 2.7% (1/37). Accessory RAMs were present in 3/37 samples (8.1%), of which one sequence contained solely E157Q (Baby33IN), another Q95K (Ad51) and a third had three accessory mutations, namely G140E, E157Q, G163R (Ad55IN). Distribution of detected mutations, including primary and secondary drug resistance mutations (DRMs) shown in Table 1. The distribution of amino acid variation among CRF02_AG was identified using INSTIs exposed (n=51) patients sequences downloaded from a specific database (https://hivdb.stanford.edu) and INSTIs unexposed patient study sequences (n=56), shown in (Fig. 2). Of the 288 IN positions, 53 (18.4%) had at least one amino acid NOP present in 0.5% or more sequences including 49 (17.1%), of which two or more polymorphisms were present. All sequences that occur at a frequency of ≥ 2% were used to study the association of polymorphisms with INSTI resistance. HIV-1 subtype CRF02_AG patients INSTIs exposed (n=51) versus INSTIs unexposed study sequences patients (n=56) were compared using two by two table (Fischer exact test). Through our test, the two NOPs occurred, namely: VI72IV* and R269K* with p-values ≤ 0.05 (Fig.3). This indicates strong evidence that the observed polymorphisms are significantly and statistically enriched.
The majority (54.1%) of our sequences were assigned to CRF02_AG and the remaining 45.9 % were infected with other subtypes (A, CRF36_cpx, F, G and C). The parental strains CRF02_AG is known to circulate in Central and Western Africa, particularly in Cameroon 9. Major RAMs to INSTIs were detected in 12.5% of the study patient sequences. These mutations were found in position 143 and 145. Mutations at position 143 are associated with high-level RAL resistance. These mutations alone have minimal effects on elvitegravir (EVG) susceptibility but, they are associated with intermediate reductions in EVG susceptibility when they occur in combination with T97A mutations 10. Y143R/C/D/G, mutation does not reduce DTG or bictegravir (BIC) susceptibility. Mutations at position 145 are associated with high-level resistance to EVG (Table 1). Other studies have reported that major INSTI associated mutations were very uncommon in INSTI-naïve patients 11, 12, as opposed to our findings, that reported the presence of RAMs against INSTIs from naïve treated patients. Accessory RAMs have been found at positions 95,140,157 and 163. The presence of the E157Q mutation in our study cohort, two patients (Baby 33 IN and add 55IN), who were infected with subtype CRF02_AG, is in agreement with a previous study that found a CRF02_AG INSTI-naïve infected patient from Cameroon that harboured the same mutation 13. E157Q is a polymorphic accessory mutation selected in-vitro by EVG and in RAL-treatment experienced patients. On its own, E157Q has no significant effect on INSTI susceptibility, but reduces the susceptibility of RAL and EVG in the presence of an N155H major RAM. We identified a viral sequence with T97A mutation, this mutation is mainly selected among treatment-experienced patients on RAL and EVG 13. Similarly, T97A has minimal effect on INSTIs susceptibility on its own, but leads to a significant reduction in RAL and EVG susceptibility in combination with Y143C/D and N155H major RAMs. The Q95K mutation is a non-polymorphic accessory mutation selected in patients on RAL and EVG. On its own, it does not affect INSTI susceptibility, but enhances the resistance of N155H mutants to RAL and EVG (https://hivdb.stanford.edu). We further identified polymorphic G140E and G163R RAMs. All of these mutations were found to be within their natural prevalence rates, and although they can confer low-level resistance to both, RAL and EVG, none of these mutations is known to reduce DTG susceptibility, neither in vitro nor in vivo 14. Three out of the 37 patients (8.1%) had the M50I polymorphic mutation that is selected in vitro by DTG and BIC in combination with R263K and it appears to reduce DTG susceptibility in combination with R263K. Moreover, 9/37 samples (24.3%) harboured L74M/I polymorphic accessory mutations commonly selected by each of the INSTIs. In ARV-naive patients, L74M occurs in 0.5% to 10% of patients and L74I occurs in 3% to 20% of patients depending on the subtype. Alone, L74M/I have minimal, if any, effect on INSTI susceptibility. However, they contribute to reduced susceptibility to each of the INSTIs when they occur with major INSTI-resistance mutations. Polymorphisms at positions that alter the binding of the drug to the integrase may influence the genetic barrier to the development of INSTI resistance 15. High frequency of amino acid change occurring at position 72 and 269 from our study viral sequences infected with CRF02_AG, was also similar to a Mozambique study that observed a high prevalence of amino acid change in patient infected with subtype C 16. Therefore, these polymorphisms (VI72IV and R269K) in our study indicated that they are significantly enriched in RAL-treated patients infected with HIV-1 CRF02_AG subtype compared with INSTI naïve patients and may thus influence the evolution of DTG resistance (Fig. 3). Finally, our results indicate that the presence of primary resistance mutations in Cameroonian IN sequences, along with high amino acid variation across diverse HIV-1 subtype is of great concern as DTG is anticipated as a generic drug in our region.

Conclusion

None of the reported mutations (P145S and Y143R/C/D/G) in our study is associated with resistance to DTG, as it is contemplated to be used in our region. We suggest that IN sequencing of all HIV-1 infected patients before INSTIs commencement to be performed to help in tailoring effective treatment strategies in the population, infected with diverse HIV1 subtypes.

References

1. Messiaen P, Wensing AMJ, Fun A, Nijhuis M, Brusselaers N, Vandekerckhove L. Clinical Use of HIV Integrase Inhibitors: A Systematic Review and Meta-Analysis. 2013; 8 (1).
2. Van Maele B, Busschots K, Vandekerckhove L, Christ F, and Debyser Z. Cellular cofactors of HIV-1 integration. Trends Biochem Sci. 2006; 31: 98–105.
3. .Martine P, Matthieu J, Ahidjo A. The origin and molecular epidemiology of HIV, Expert Review of Anti-infective Therapy.2013; 11 (9): 885-896.
4. Derache A, Traore O, Koita V, Sylla A, Tubiana R, Simon A, Canestri A, Carcelain G, Katlama C, Calvez V, Cisse M, Marcelin AG. Genetic diversity and drug resistance mutations in human immunodeficiency virus type 1 from untreated patients in Bamako, Mali. Antivir Ther. 2007; 12:123–129.
5. Fransen S, Gupta S, Danovich R, Hazuda D, Miller M, Witmer M, et al. Loss of raltegravir susceptibility by human immunodeficiency virus type 1 is conferred via multiple nonoverlapping genetic pathways. J Virol. 2009; 83: 11440–11446.
6. Brado D, Obasa A, Ikomey G, Cloete R, Singh K, Engelbrecht S, Neogi U, Jacobs G. Analyses of HIV-1 integrase sequences prior to South African national HIVtreatment program and available of integrase inhibitors in Cape Town, South Africa. Scientific report.2018; 8 (1): 4709
7. Jacobs G, Laten A, van Rensburg E, Bodem J, Weissbrich B, RethwilmA, Preiser W, Engelbrecht S. Phylogenetic diversity and low-level antiretroviral Dolutegravir resistance mutations in HIV Type 1 treatment-naive patient from Cape Town, South Africa. AIDS Research and Human Retroviruses.2008; 24: 1009-1012.
8. Tom Hall, Ibis Biosciences, An Abbott company, 2251 Faraday Avenue, Carlsbad, CA 92008,2013; BioEdit v7.1.11. 760-476-3375.
9. Tongo M, Martin DP, Zembe L, Eitel MN, Carolyn W, Wendy AB. Characterization of HIV-1 gag and nef in Cameroon: further evidence of extreme diversity at the origin of the HIV-1 group M epidemic. Virol J.2013; 10: 29,
10. Reigadas S, Masquelier B, Calmels C, et al. Structure-analysis of the HIV-1 integrase Y143C/R raltegravir resistance mutation in association with the secondary mutation T97A. Antimicrob Agents Chemother. 2011; 55:3187-3194.
11. Nguyen HL, Ruxrungtham K, Delaugerre C: Genetic barrier to the development of resistance to integrase inhibitors in HIV-1 subtypes CRF01_AE and B. Intervirology. 2012; 55: 287–295.
12. Piralla A, Paolucci S, Gulminetti R, Comolli G, Baldanti F: HIV integrase variability and genetic barrier in antiretroviral naive and experienced patients. Virol J .2011; 8: 149.
13. http://hivdb.stanford.edu.
14. Abram, M. E. et al. Lack of impact of pre-existing T97A HIV-1 integrase mutation on integrase strand transfer inhibitor resistance and treatment outcome. PLoS One .2017;12.
15. Low A, Prada N, Topper M, Vaida F, Castor D, Mohri H. Natural polymorphisms of human immunodeficiency virus type 1 integrase and inherent susceptibilities to a panel of integrase inhibitors. Antimicrob Agents Chemother. 2009; 53: 4275–4282
16. Michelli O, Montagna C, Falasca F, Bucci M, Russo G, Lichtner M, et al: Short communication: analysis of the integrase gene from HIV type 1-positive patients living in a rural area of West Cameroon. AIDS Res Hum Retroviruses 2012; 28: 1729–17.