1 and 12 Therefore, this study was designed to assess whether the -675 4G/5G PAI-1 gene polymorphism is associated with obesity and insulin resistance in Mexican children. A cross-sectional study was performed in 174 children, 89 with normal weight and 85 with obesity, aged

between 6 and 13 years. All children were from the state of Guerrero, Mexico, and recruited from three primary schools in the city of Chilpancingo, Mexico. An informed JQ1 nmr consent was obtained from all parents before enrollment of children in the study. Approval for the study was obtained from the Research Ethics Committee of the University of Guerrero according to the ethical guidelines of the Declaration of Helsinki. Body weight was determined using a Tanita body composition monitor (Tanita BC-553 = Arlington, USA), and height was measured to the nearest 0.1 cm using a stadiometer (Seca – Hamburg, Germany). Body circumferences were measured in duplicate using a diameter tape

accurate to within ± 0.1 cm (Seca 201 – Hamburg, Apoptosis inhibitor Germany). Waist circumference was measured at the level of the umbilicus and the superior iliac crest. Hip circumference was measured at the maximum point below the waist, without compressing the skin. The thickness of four skinfolds was measured to the nearest 0.1 mm, in duplicate, using a skinfold caliper (Dynatronics Co – Salt Lake City, USA): triceps, biceps, subscapular, and suprailiac. The duplicate measures were averaged. The classification of obesity was made using the 2000 Centers for Disease Control and Prevention growth charts, which defined normal weight as the 5th to 85th percentiles, and obesity as ≥ 95th percentile. Blood samples were obtained from antecubital venipuncture after overnight fast. Serum glucose was analyzed with semi-automated equipment (COBAS MIRA). Insulin levels were determined by immunoenzymatic assay (GenWay INS-EASIA kit). The homeostasis model assessment was used to determine insulin resistance (IR) in children; this score was calculated with the following formula: fasting serum insulin (μU/mL) x fasting plasma glucose (mmol/L)/22.5.

Insulin resistance was defined as a homeostasis model assessment for insulin Etomidate resistance (HOMA-IR) above the 75th percentile for all children (HOMA-IR ≥ 2.4). The extraction of genomic DNA (gDNA) was performed from leukocytes obtained from whole blood samples, according to the Miller method. The -675 4G/5G PAI-1 gene polymorphism was screened by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method, using following primers: 5′CACAGAGAGAGTCTGGCCACGT3′ (forward), and 5′CCAACAGAGGACTCTTGGTCT3′ (reverse). PCR was carried out in a final volume of 25 μL containing 1 μg of DNA, 0.06 μM of each oligonucleotide, 1.25 U/μL Taq DNA polymerase, supplied buffer enzyme 1X, 1.5 mM MgCl2, and 0.1 mM of each dNTP (Invitrogen™ life technologies).