The approximate effective lifetime τ eff of a symmetrically PD0325901 solubility dmso passivated silicon wafer can be expressed as 1/τ eff = 1/τ b + 2S eff/W, where τ b is the bulk lifetime, W is the crystalline silicon (c-Si) wafer thickness, and S eff is the effective SRV. The bulk lifetime was estimated at about 1 ms using the I2 passivation method to determine S eff. Figure 4 shows that S eff was linear with 1/Q f 2 for negative Q f values >6.8 × 1011 cm-2, except for the sample annealed at 750°C. The linear relationship of samples annealed between 400°C and 700°C indicated that passivation was dominated by field-effect passivation (Q f). Thus, the sample annealed at 300°C (dislocated line) indicated that Q f of 2.5

× 1011 cm-2 was too low to dominate surface passivation, which confirmed the conclusion drawn from Figure 3. This result also agreed with the simulation of Hoex et al. for p-type c-Si [5]. Based on

the dislocation of the sample annealed at 750°C, a high interface trap density was inferred to destroy the field-effect passivation and increase S eff. Figure 4 Plot of S eff and 1/ Q f 2 with the linear fit for annealing temperatures. The annealing temperatures are between 400°C to 700°C (Q f> 6.8 × 1011cm-2). The slightly bent linear fit line was due to the logarithmic X- and Y-axes. DBAR analysis at different annealing temperatures DBAR analysis was performed at the Beijing Slow Positron Beam (Institute of High Energy Physics, Chinese Academy of Sciences, Beijing, China). A positron beam generated from a Na22 radioactive source was used, and the energy of the positrons was modulated between 0 and 10 keV to obtain the PD-332991 incident energy profile of positron annihilation. The energy region of the S parameter ranged from 510.24

to 511.76 keV, whereas the W parameter ranged from 504.2 to 508.4 and from 513.6 to 517.8 keV. Thus, the total energy region of the peak ranged from 504.2 to 517.8 keV. The vacancy defects in the alumina films were mainly Al vacancies, O vacancies, http://www.selleck.co.jp/products/Paclitaxel(Taxol).html and clusters of vacancies (voids) [13, 17, 18]. O vacancies with a positive charge (F+- and F2+-type defects) have difficulty trapping positrons because of their identical charge. Nobuaki Takahashi et al. [19] calculated the defect energetics using first-principle calculations and found that the oxygen vacancy has a much higher formation energy than the aluminum vacancy [19], further supporting the view that few positrons are trapped in charged O vacancies. Therefore, Al and neutral O vacancies (F center) are crucial to the annihilation results in the present study. Figure 5a,b shows the measured S and W parameters as a function of the incident positron energy for samples annealed at different temperatures for 10 min. In Figure 5a, the shapes of the three curves are similar because the deposition conditions of the three films were identical, and the substrates on which these films grew were also the same.

The culture medium pH increased in parallel with bacterial growth, indicating ammonia production by growing bacteria (Figure 1A). Viable cell count analysis also revealed that the number of cells in aerobic cultures was 3-4 times higher than that in microaerobic cultures at 24 h, but rapidly decreased after 48 h. In contrast, a rapid drop in viable cell count was observed in cultures grown without CO2, and no viable cells were detected at 36 h. In this first experiment, we took measurements from aliquots obtained from the culture

flasks at each time point; the flasks were then refilled with the appropriate gas mixtures and incubated further for subsequent analysis. As a result, cultures grown under 2% or 8% O2 tension were exposed to atmospheric oxygen during sampling, which may have Selleck Ku-0059436 affected results. Figure 1 Atmospheric level of O 2 stimulates Hp growth in check details the presence of CO 2 . Hp 26695 cells collected from agar plates were inoculated into BB-NBCS at 5 × 107 CFU/ml (A and B) or 3 × 104 CFU/ml (C) and cultured under 2%, 8%, or 20% O2 tension in the absence or presence of 10% CO2. An aliquot of each culture was taken at the indicated time points to determine absorbance at 600 nm, culture media pH, and viable cell counts. For data shown in A and C, each flask was refilled with the appropriate gas mixture and incubated for measurements at later time points. For

data shown in B, 15 flasks were inoculated with the preculture, filled with mixed gas, and incubated. One flask was used at each time point for measurements; flasks were used only once to

prevent exposure of cultures to atmospheric oxygen. Absorbance at 600 nm and media pH data shown in A and C are expressed as mean ± SD of triplicate cultures and are representative of ten and three experiments, respectively. Data shown in B are mean ± SD of four independent experiments. Colony counting data are representative of four independent experiments with similar results. To verify our results, we inoculated 15 flasks with a preculture, filled with the appropriate gas mixtures, and incubated. At each time point, we measured the bacterial growth and culture medium pH of one flask of Alectinib each gas condition. Flasks were sampled only once to prevent exposure of cultures to atmospheric O2. The growth profiles were similar to those presented in Figure 1A, but absorbance values were generally lower and culture medium pH increased only modestly (Figure 1B). However, without periodic exposure to atmospheric O2, Hp growth was much lower under 8% O2 tension. These results confirmed that 20% O2 does not kill Hp but increases growth compared with 2% or 8% O2. Bury-Moné et al. reported that Hp lost its microaerophilic properties, demonstrating similar growth profiles under 5% and 21% O2 tension when inoculated at a high cell density but not at low density [31]. In the present study, we inoculated cells to an OD600 of 0.

Unless otherwise stated, a p value <0.05 was taken as significant. Results Group A comprised 22 patients who received 18 months of teriparatide therapy for new-onset adjacent VCFs after PMMA vertebroplasty. Navitoclax ic50 The comparison group (group B) included 22 patients who received

antiresorptive agents for at least 18 months. All 44 patients received vitamin D and calcium supplementation. Table 1 summarizes the comparison of clinical data between the two groups. There was no significant difference in male-to-female ratio, body mass index, injected volume of PMMA, steroid use, current smoking, alcohol drinking, PD-0332991 chemical structure or rheumatic arthritis between the two groups. The mean age of the patients in group A (75.59 ± 6.28) was significantly older than that of the patients in group B (70.55 ± 4.10, p = 0.002). The number of pre-existing VCFs was significantly higher in group A (3.01 ± 0.87) than in group B (2.17 ± 0.66, p = 0.004).

The baseline BMD was 0.5796 ± 0.0816 g/cm2 in group A and 0.6245 ± 0.1026 g/cm2 in group B (p = 0.056). The vertebral body reduction ratio in group A was 48.68% ± 11.94%, while in group B, it was 49.82% ± 12.19% (p = 0.756). Table 1 Comparison of clinical data between groups A and B   Group A Group B p value Age (years) 75.95 ± 6.28 70.55 ± 4.10 0.002* Gender (F/M) 20:2 20:2 1.000 BMI 23.16 ± 3.43 25.34 ± 4.35 0.367 Pre-existing fracture 3.01 ± 0.87 2.17 ± 0.66 0.004* VB reduction ratio (%) 48.68 ± 11.94 49.82 ± 12.19

Cyclin-dependent kinase 3 0.756 PMMA amount (ml) 4.64 ± 1.32 4.68 ± 1.37 0.572 Baseline BMD (T-score) 0.5796 ± 0.0816 0.6245 ± 0.1026 0.056 (−3.76 ± 0.71) (−3.45 ± 0.73) 0.073 Baseline JOA score 9.95 ± 4.02 11.59 ± 3.46 0.115 Baseline VAS score 8.27 ± 1.16 8.13 ± 0.95 0.888 Steroid use 5 4 0.446 Current smoking 5 5 1.000 Alcohol 6 5 0.716 Rheumatic arthritis 2 2 1.000 Follow-up period (months) 25.05 ± 3.42 24.63 ± 3.48 0.517 *p < 0.05 Teriparatide (20 μg) was subcutaneously injected once daily, and oral calcium and vitamin D supplements were given for at least 18 months to the 22 patients in group A. Two patients experienced mild leg muscle spasms or cramps after injection of teriparatide. The symptoms subsided within 5 days in one patient and within 14 days in the other. The mean VAS score at baseline was 8.27 ± 1.16 (range, 6–10) (Fig. 2). After 1 month of treatment, the mean VAS score was 4.23 ± 0.97. The mean VAS score decreased to 2.23 ± 0.61 after 6 months, 1.20 ± 0.96 after 12 months, and 1.18 ± 0.80 (range, 0–3) after 18 months of teriparatide treatment (p = 0.001, all the differences between baseline and 6 months, 6 months and 12 months, and 12 months and 18 months were significant).

Mar Chem 70:105–119CrossRef Liu H, Probert I, Uitz J, Claustre H, Aris-Brosou S, Frada M et al (2009) Extreme diversity in noncalcifying haptophytes explains a major pigment paradox in open oceans. Proc Natl Acad Sci USA 106:12803–12808PubMedCentralPubMedCrossRef Mann S (2001) Biomineralization: principles and

concepts in bioinorganic materials chemistry. Oxford University Press, Oxford Miles H, Widdicombe Ribociclib S, Spicer JI, Hall-Spencer J (2007) Effects of anthropogenic seawater acidification on acid–base balance in the sea urchin Psammechinus miliaris. Mar Pollut Bull 54:89–96PubMedCrossRef Orr JC, Fabry VJ, Aumont O, Bopp L, Doney SC, Feely RA et al (2005) Anthropogenic ocean acidification over the twenty-first century and its impact on

calcifying organisms. Nature 437:681–686PubMedCrossRef Read BA, Kegel J, Klute MJ, Kuo A, Lefebvre SC, Maumus F et al (2013) Pan genome of the phytoplankton Emiliania underpins its global distribution. Nature 499:209–213PubMedCrossRef Richier S, Fiorini S, Kerros ME, Peter von Dassow PV, Gattuso JP (2010) Response of the calcifying coccolithophore Emiliania huxleyi to low pH/high pCO2: from physiology to molecular level. Mar Biol 158:551–560PubMedCentralPubMedCrossRef Riebesell U, Zondervan RostB, Tortell PD, Zeebe RE, Morel FMM (2000) Reduced calcification of marine plankton in response to increased atmospheric CO2. Nature 407:364–367PubMedCrossRef Ross PM, Parker L, O’Conner WA, Bailey EA (2011) The impact of ocean acidification on reproduction, early development and settlement of marine SAHA HDAC Tacrolimus (FK506) organisms. Water 3:1005–1030CrossRef Satoh M, Iwamoto K, Suzuki I, Shiraiwa Y (2009) Cold stress stimulates intracellular calcification by the coccolithophore, Emiliania huxleyi (Haptophyceae) under phosphate-deficient conditions. Mar Biotechnol 11:327–333PubMedCrossRef Sekino K, Shiraiwa

Y (1994) Accumulation and utilization of dissolved inorganic carbon by a marine unicellular coccolithophorid, Emiliania huxleyi. Plant Cell Physiol 35:353–361 Sorrosa JM, Satoh M, Shiraiwa Y (2005) Low temperature stimulates cell enlargement and intracellular calcification of coccolithophorids. Mar Biotechnol 7:128–133PubMedCrossRef Swift E, Taylor W (1966) The effect of pH on the division rate of the coccolithophorid Cricosphaera elongata. J Phycol 2:121–125CrossRef Veron JE, Hoegh-Guldberg O, Lenton TM, Lough JM, Obura DO, Pearce-Kelly P et al (2009) The coral reef crisis: the critical importance of <350 ppm CO2. Mar Pollut Bull 58:1428–1436PubMedCrossRef Zeebe RE, Zachos JC, Calderia K, Tyrrell T (2008) Carbon emissions and acidification. Science 321:51–52PubMedCrossRef Zondervan I, Zeebe RE, Rost B, Riebesell U (2001) Decreasing marine biogenic calcification: a negative feedback on rising atmospheric pCO2.

Louis, MO, USA). All parasite cultures were washed three times in a saline solution, counted, adjusted and added to macrophage cultures at a ratio of 10:1. Macrophage cultures Inflammatory peritoneal macrophages were elicited using a 3 mL intraperitoneal injection of 3% thioglycolate solution (Sigma) in C57BL/6 or CBA mice. After 96 h, all animals were

euthanized and the elicited peritoneal macrophages were obtained as previously described [3]. The cells were suspended in complete Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco) [DMEM supplemented with 10% fetal bovine serum (Gibco), 2 g/L sodium bicarbonate (Sigma), 25 mM HEPES (Sigma), 1 mM glutamine (Sigma) and 0.2% ciprofloxacin (Halexistar, Goiania, GO, BR)] and distributed in 6-well plates at a concentration of 1 × 107 macrophages per well. Cultures were subsequently incubated overnight Stem Cells inhibitor at 37°C in 5% CO2. Macrophage infection The inflammatory peritoneal macrophage cultures were infected for 12 h with L. amazonensis stationary phase promastigotes. Cell cultures were then washed twice with saline to remove non-internalized

parasites and reincubated for an additional six or 24 h before either RNA extraction or fixation with ethanol for 20 min followed by staining with hematoxylin and eosin (H&E). Each independent experiment was repeated three times for microarray analysis, and each experiment was performed at least three times in triplicate for microscopic analysis. Microarray analysis Total Bafilomycin A1 RNA from uninfected or L. amazonensis-infected macrophages was prepared using Qiagen RNeasy mini-prep columns (Qiagen, Valencia, CA, USA) in accordance with manufacture protocols. The integrity of each RNA preparation was assessed using agarose gel electrophoresis. The RNA was reverse transcribed using Superscript II (Invitrogen, Carlsbad, CA, USA) in the presence of oligo(dT) primers linked to a T7 RNA polymerase promoter sequence (Proligo, La Jolla, CA, USA) to prime cDNA

synthesis. After second-strand synthesis, biotinylated cRNA was produced by in vitro transcription using biotinylated UTP and CTP (Bioarray high-yield RNA transcript labeling kit, Enzo Diagnostics, Farmingdale, NY, USA) and purified with RNAeasy mini columns (Qiagen). The biotinylated cRNA was tetracosactide fragmented at 94°C for 30 min. For probe array hybridization and scanning, 16 μg of fragmented labeled cRNA was hybridized to the Murine Genome U74v2 GeneChip® array (Affymetrix, Santa Clara, CA, USA), which contains nearly 400,000 probe sets covering approximately 12,000 different murine genes. Array scanning was performed using the Affymetrix® GeneChip Scanner 3000 7 G and all images were analyzed using Microarray Analysis Software (Affymetrix v5.0). Experimental data are available online at ArrayExpress (E-MEXP-3448).

ESI MS: m/z = 560.1 [M+Na]+ (100 %). General method for the preparation of arylpiperazine derivatives of 2-(4-bromobutyl)-4,10-diphenyl-1H,2H,3H,5H-indeno[1,2-f]isoindole-1,3,5-trione (12–19) A mixture of derivative (11) (0.3 g, 0.0005 mol) and the corresponding amine (0.001 mol), RAD001 cell line anhydrous K2CO3 (0.3 g), and catalytic amount of KI were refluxed in acetonitrile for 30 h. Then the mixture was filtered off and the solvent

was evaporated. The yellow residue was purified by column chromatography (chloroform:methanol 9.5:0.5 vol) and/or crystallized from methanol. Obtained compounds were converted into their hydrochlorides. The solid product was dissolved in methanol saturated with gaseous HCl. The hydrochloride was precipitated by addition of diethyl ether. The crude product was crystallized from appropriate solvent. 4,10-Diphenyl-2-[4-(4-phenylpiperazin-1-yl)butyl]-1H,2H,3H,5H-indeno[1,2-f]isoindole-1,3,5-trione (12) Yield: 87 %, m.p. 231–232 °C. 1H NMR (DMSO-d 6) δ (ppm): 7.61 (t, 3H, CHarom., J = 3.6 Hz), 7.56–7.44 (m, 8H, CHarom.), 7.40–7.31 (m, 2H, CHarom.), 7.28–7.23 (m, 2H, CHarom.), 6.98 (d, 2H, CHarom., J = 8.1 Hz), 6.86 (t, 1H, CHarom., J = 7.2 Hz),

6.23 (d, 1H, CHarom., J = 6.6 Hz), 3.76 (d, 2H, CH2, J = 11.4 Hz), 3.49–3.42 (m, 4H, CH2), 3.15–3.02 (m, 6H, CH2), 1.72–1.69 (m, p53 inhibitor 2H, CH2), 1.57–1.52 (m, 3H, CH2). 13C NMR (CDCl3) δ (ppm): 190.32, 165.58, 2-hydroxyphytanoyl-CoA lyase 165.37, 149.52, 148.83, 141.58, 137.54, 135.13, 134.77, 134.39, 134.12, 133.94, 132.22, 130.47, 129.63 (2C), 129.41 (4C), 128.85 (2C), 128.49 (4C), 128.36 (2C), 127.24 (3C), 124.11, 123.53, 57.84, 57.65, 50.97, 50.86, 36.63, 34.50, 29.57, 26.48. ESI MS: m/z = 618.4 [M+H]+ (100 %). 4,10-Diphenyl-2-4-[4-(pyridin-2-yl)piperazin-1-yl]butyl-1H,2H,3H,5H-indeno[1,2-f]isoindole-1,3,5-trione (13) Yield: 90 %, m.p. 219–220 °C. 1H NMR (DMSO-d 6) δ (ppm): 8.14 (d, 1H, CHarom., J = 3.9 Hz), 7.82–7.74 (m, 1H, CHarom.), 7.61 (t, 3H, CHarom., J = 3.6 Hz), 7.56–7.48 (m, 8H, CHarom.),

7.40–7.31 (m, 2H, CHarom.), 7.19–7.02 (m, 1H, CHarom.), 6.84 (t, 1H, CHarom., J = 6.0 Hz), 6.23 (d, 1H, CHarom., J = 6.9 Hz), 4.37 (d, 2H, CH2, J = 15.0 Hz), 3.52–3.31 (m, 6H, CH2), 3.06–2.99 (m, 4H, CH2), 1.68–1.67 (m, 2H, CH2), 1.56–1.55 (m, 2H, CH2). 13C NMR (CDCl3) δ (ppm): 190.02, 165.63, 165.27, 153.84, 147.79, 141.44, 137.41, 135.58, 134.62, 134.29, 134.07, 133.68, 132.15, 130.32, 129.46 (2C), 129.39 (3C), 128.69 (2C), 128.38 (3C), 128.28, 128.20 (2C), 127.17 (3C), 124.46, 123.74, 52.35, 51.98, 48.79, 58.23, 36.96, 34.86, 27.62, 26.13.

TZ and YL wrote the paper. All authors read and approved the final manuscript.”
“Background Whiteflies (Hemiptera: Aleyrodidae) are an extremely important group of agricultural insect pests that cause serious damage by weakening plants, excreting honeydew and transmitting several hundreds of plant viruses

[1]. The most economically important of these is the cosmopolitan sweetpotato whitefly Bemisia tabaci (Gennadius), which is a species complex of more than 20 biotypes. The B and Q biotypes, among the most predominant and damaging worldwide, differ in many biological parameters, including resistance to insecticides, ability to damage selleck kinase inhibitor plants [2] and tolerance to environmental conditions [3]. Another important whitefly insect pest is the greenhouse whitefly Trialeurodes vaporariorum

(Westwood) which is less important as a virus vector, but causes serious damage by direct feeding on plants. Whereas T. vaporariorum can be identified based on external morphology (Figure 1), B. tabaci biotypes are only well defined by DNA markers [4]. Figure 1 Whiteflies in Croatia. Demonstration of heavy whitefly infestations on cucumbers grown in the coastal part of Croatia (A), and external phenotypical differences between B. tabaci and T. vaporariorum (B). Symbiosis is quite common among known whitefly species. Both B. tabaci and T. vaporariorum harbor the primary obligatory bacterium Portiera aleyrodidarum, which supplements their unbalanced diet [5]. B. tabaci can also harbor a diverse array of facultative learn more secondary symbionts, including the Gammaproteobacteria Tolmetin Arsenophonus (Enterobacteriales), Hamiltonella (Enterobacteriales) [5, 6], Fritschea (Chlamydiales) [7] and Cardinium (Bacteroidetes)

[8], and the Alphaproteobacteria Rickettsia (Rickettsiales) [9] and Wolbachia (Rickettsiales) [10]. A clear association between B. tabaci biotypes and secondary symbionts has been observed in Israeli populations: Hamiltonella is detected only in the B biotype, Wolbachia and Arsenophonus only in the Q biotype, and Rickettsia in both biotypes [11]. Fritschea has only been detected in the A biotype from the United States [12], and only Arsenophonus has been associated with T. vaporariorum [13]. Virtually nothing is known about the functions these symbionts might fulfill in whiteflies. However, in other arthropods, they may influence their host’s nutrition, host plant utilization and ability to cope with environmental stress factors, induce resistance to parasitoids, and effect reproductive manipulations [14]. For example Wolbachia, Cardinium, Rickettsia and Arsenophonus are known to manipulate reproduction in a wide range of insect species by inducing cytoplasmic incompatibilities or sex ratio bias [15–18]. Hamiltonella defensa induces parasitoid resistance in the pea aphid [19], whereas Fritschea bemisiae has no known effect.

Here, the intensive study of microstructures reveals some novel characteristics in the remaining two groups of kinks in InP NWs, i.e., approximately 90° kinks and 170° kinks. As presented in Figure 4a, an approximately 90° kink can be clearly observed. The inset gives its corresponding SAED pattern, in which each diffraction spot indicated by white arrows was split into adjacent irregular spots. It indicates that the

crystal orientation makes slight changes in this area. It is evidenced in Figure 4b that the amorphous regions pointed by arrows are firstly observed in the approximately 90° kink, where the crystal orientation is disordered. This result could guide us presenting reasonable explanations for the formation of approximately 90° kinks. In crystallography, it is not easier to form an approximately MG-132 solubility dmso 90° angle by the glide of 111 planes. Therefore, in order to produce such shape, the change of crystal lattice becomes reasonable. EPZ-6438 chemical structure It is known that amorphorization could distort the crystal lattice and break the barrier for the transition of morphology in the

growing process. As a result, the growth of NWs would become more flexible, which is beneficial to the formation of approximately 90° kinks. Figure 4 BF image with corresponding SAED pattern and HRTEM image of approximately 90° kink in InP NWs. (a) BF image of the kink of approximately 90° in InP NWs. The inset is SAED pattern corresponding to the kink in which the diffraction spots indicated by white arrows are split into irregular spots. (b) HRTEM image of the selected area in (a). The observed amorphous regions are pointed by arrows. As for the slight

bendings, i.e., approximately 170° kinks, careful examinations show that the Y-27632 2HCl small-angle boundary exists in the bending area, being rarely observed in III-V semiconductor NWs [16]. As depicted in Figure 5a, the InP NWs are slightly bent in which planar defects could be easily observed. Furthermore, as given in Figure 5b, a small-angle boundary was clearly seen in the selected area of Figure 5a. The extra atomic planes are inserted as indicated by arrows. This result is similar to that observed in Au NWs [21]. In the growing process, the NWs are likely to be affected by the disturbance of growth conditions, such as the gas flow fluctuation. As a result, the atomic arrangement is likely to collapse and tend to reconstruct in order to accommodate the disturbance effect, which causes the formation of small-angle boundary. The inserted extra atomic planes could generate unbalanced internal stress for the growth of the upper side and lower side of InP NWs shown in Figure 5b. Consequently, the InP NWs show slight bending. In addition, depending on the simulation of Cao et al. [22], the motion of dislocations along the well-defined slip systems can be restricted by twin boundaries (TBs).

This enabled us to distinguish between

the proteolytic effect of ClpP on misfolded proteins, and how this affected growth at low temperature, and the indirect effect of ClpP caused through degradation of RpoS. Similar to the clpP mutant, we have previously shown that a mutant in the carbon starvation regulator protein gene, csrA, cause accumulation of high levels of RpoS [13]. Since we demonstrate in the current study that high level of RpoS in a clpP mutant appears to affect growth at low temperature, we hypothesised that a csrA mutant in a similar way would be growth attenuated, and included an investigation of this gene as well. Result and discussion A clpP AZD1208 mutant is impaired for growth at low temperature Growth of the clpP mutant was impaired on LB agar at 10°C (Figure 1A), whereas colony formation was delayed but resulted in normal size colonies at 15 and 21°C (Figure 1A). The temperature of 10°C was selected to represent the lower part of the temperature growth

range of S. Typhimurium and still allow growth experiments to be carried out within a reasonable time. With increasing incubation time at 10°C, two growth phenotypes of the clpP mutant appeared: normal sized colonies and pin-point colonies. To test if the pin-point colonies were just small due to longer doubling time, the plate with the clpP mutant was transferred to 37°C after 12 days at 10°C, grown overnight and compared with wild type strain that had also grown overnight. Normal sized colonies were formed and the cell density corresponded to the wild type strain Tanespimycin concentration (Figure 1B). This showed that the clpP mutant was able

to restore normal growth even after a long period at 10°C. Figure 1 ClpP and CsrA are important for growth at low temperature. A) S. Typhimurium C5 and isogenic mutants were grown exponentially in LB at 37°C up to an OD600 of 0.4. The cultures were then serially diluted (10−1-, 10−2-, 10−3-, 17-DMAG (Alvespimycin) HCl and 10−4-fold), and 10 μl of each dilution was spotted onto LB plates. The plates were incubated at 10, 15, 21 and 37°C. The result presented is representative at least two experiments. B) The clpP are diluted as in a) and grown first at 10°C for 12 days and then transferred to 37°C for 1 day. A culture grown at 37°C for 1 day is included as control. The lag phase of the wild type C5 strain was 2.04 ± 0.66 days when grown in LB broth at 10°C, whereas the clpP mutant had a significantly longer lag phase of 9.97 ± 1.94 days (p = 0.002) (Figure 2A). The growth rate of the clpP mutant in exponential phase was 0.45 ± 0.03 days, which was a 29% reduction compared to the wildtype. The maximal density of the clpP mutant (8.29 log10 CFU/ml) was comparable to that of the wild type (8.74 log10 CFU/ml) after prolonged incubation (Figure 2B).

6661 Chromosome 1 (ribosome assembly protein Noc2) Asp 446 CGATCATGTTTGCCTGAGGA CCGACAGCATCGAGCAACTA 59 21 1-4 0.5971 Nutlin-3a in vitro Chromosome 1 (non coding) Asp 165 TGATGGGCCGCAGTCG GCACCTGCTTGTCGATTCGT 60 10 0-6 0.7296 Chromosome 5 (non coding) Asp 252 CAGATTGGAGACACGAAGCG ACCACGGATTGCCAAGGA 58 12 2-6 0.5886 Chromosome 5 (non coding) Asp 345 TCTCCAACCCTTCGGACG GCCGGAAGAGCATGAAGACA 58 11 1-6 0.5771 Chromosome

5 (non coding) Asp 204 GATGCGGGAGGTGGGTC CGTCCTCACTTTTGCCTTGG 58 11 1-5 0.6128 Chromosome 6 (non coding) Asp 20 GGGAAGAGAGGAACCGATCC CGCAGTGGGCAGTTTGAAT 58 10 0-4 0.7520 Chromosome 8 (non coding) *Each index was calculated with the results from 57 unrelated A. fumigatus isolates Accessibility through the web A database was created with the results of the present study http://​minisatellites.​u-psud.​fr/​MLVAnet/​.

On this website, it is possible to compare VNTR patterns with 300 different patterns included in the database using complete panel of markers or just a selection of them. This database also allows to build dendrograms with the query. All the possibilities provided by the website and database are explained by Grissa et al. [18]. Specificity When VNTR primer sets were tested with DNA from Aspergillus flavus, A. niger and A. nidulans no amplification was observed. When VNTR primer sets were tested Ibrutinib concentration with DNA from Aspergillus lentulus, a species closely related to A. fumigatus, amplification was obtained with 3 out of 10 markers (Asp_167, Asp_202 and Asp_330). As a consequence the combination of 10 VNTRs should be considered as specific of A. fumigatus. Clustering analysis A total number of 330 A. fumigatus isolates were typed with the panel of 10 VNTRs. This analysis yielded 255 different

genotypes. Only 33 genotypes were shared by two isolates or more. UPGMA analysis did not allow a clear clustering of the isolates (data not shown). Some isolates (n = 12) were characterized by the insertion of a large sequence (about 450 bp) in VNTR Asp_20 whereas others (n = 6) had a very high number of repeats (from 10 to 17) in the VNTR Asp_202 and (from 10 to 15) in the VNTR Asp_330, exhibiting patterns which were not observed in the group of unrelated isolates (Table 3). The graphing algorithm termed Minimum Spanning Tree (MST) demonstrated three major clusters Silibinin of isolates (Figure 2). The first cluster comprised 91 out of 95 avian isolates (95%) collected in the two duck farms in Sarthe department in France. The second cluster comprised 42 out of 62 avian isolates (70%) collected in poultry farms in Guangxi province in China and the third cluster comprised 90 out of 120 environmental isolates (75%) from the turkey hatchery in Maine-et-Loire department in France. In the dendrogram, genotypes corresponding to unrelated isolates are clearly separated. Figure 2 Minimum spanning tree of 330 A. fumigatus isolates based on categorical analysis of 10 VNTRs. Each circle represents a unique genotype.