97 Down-regulation of these proteins by hypoxia was associated with a decreased level of HRR activity as measured by the internal reporter system. Furthermore, they observed that decreased levels of

these HRR proteins was due to reduced translation of corresponding mRNAs, suggesting involvement of the mTORC1 or UPR pathways described above. They also demonstrated that depressing HRR by chronic hypoxia increased the cells’ sensitivity to the DNA cross-linking agents mitomycin C and cisplatin, and to radiation.92 Recently, a new pathway to down-regulate one of HRR gene, RAD52, by hypoxia was reported. Crosby et al. showed that HIF1-dependent up-regulation of the micro-RNAs, mir-210 and mir-373, results in suppression of RAD52 transcription.98 They showed that both micro-RNAs interact with the 3′ untranslated region of RAD52, suggesting that mir-210 and mir-373 are responsible for the repression KU-60019 research buy of RAD52.98 Taken together, these buy Palbociclib results suggest that

depression of HRR by hypoxia may force a cell to use error-prone NHEJ that generates many genetic alterations. Yuan et al. showed that hypoxia increases the UV-induced mutation rate in tissue culture cells, suggesting that hypoxia represses nucleotide excision repair (NER).99 Later, Crosby et al. showed that hypoxia up-regulates mir-373, which in turn degrades the RAD23B transcript, one of the genes involved in NER.98 RAD23B recognizes UV-induced DNA damage in association with XPC and this complex recruits proteins, including XPA, RPA, XPB and XPD, for DNA unwinding. A small patch of single-stranded DNA containing damage is excised by XPG and XPF/ERCC1, and repaired and sealed by polymerase and ligase, respectively.100 Thus, repression of RAD23B by hypoxia can impair NER. During replication, DNA polymerase sometimes incorporates a wrong base generating a mismatch or generates a single-stranded loop within a highly repetitive sequence,

for instance at a microsatellite locus. These mistakes are repaired prior to mitosis by the MMR pathway. There are six MMR proteins involved in this system in humans, MSH2, MSH6, MSH3, MLH1, PMS2 and MLH3. The recognition of mismatch or loops containing one nucleotide Reverse transcriptase is mainly mediated by MutSα (a heterodimer of MSH2 and MSH6). Recognition of a loop containing two or more nucleotides is mediated by MutSβ.101 Excision of a mismatched base or a loop on a newly synthesized strand is initiated by recruited MutLα (a heterodimer of MLH1 and PMS2) or MutLβ (a heterodimer of MLH1 and MLH3) and followed by exonuclease (EXO1). Re-synthesis is done by DNA polymerase and the nick is sealed by DNA ligase.101 If one of six MMR proteins is disabled, the mutation frequency in the microsatellite sequences increases. The microsatellite slippage mutations described above are associated with hypoxia-induced repression of MMR proteins, including MSH2, MSH6, MSH3, MLH1 and PMS2.85–87 Mihaylova et al. first demonstrated that severe chronic hypoxia (<0.

The majority of participants were male (73%) with a median age of 44.5 years (IQR 39.5–49.6 years). One hundred

and twenty persons (13%) self-identified as being of aboriginal ethnicity (First Nations or Metis). The proportion BTK phosphorylation of aboriginal participants varied regionally and was much higher in British Columbia (33%), Alberta (21%) and Ontario (14%) compared with Quebec (1.5%). Aboriginals were more likely to be female compared with non-aboriginals (52% vs. 22%, respectively; P < 0.001). Most participants were living below the poverty line (76% with a gross monthly income < CDN$1500) and only 13% had achieved greater than high school education. Participants living in British Columbia and Quebec were the most socially disadvantaged. Overall, 458 (57%) had been previously incarcerated (78% of aboriginals vs. 53% learn more of non-aboriginals; P < 0.001), 422 (44%) reported a psychiatric diagnosis, 25 (3%) were homeless and 67 (7%) lived in shelters at cohort entry. There were very high rates of past and current (past 6 months) substance use among participants, with 81% reporting a history of IDU (38% were currently injecting; 23% sharing needles); 50% were current

alcohol drinkers (31% reported binge/hazardous drinking, defined as >6 drinks/day) and 77% currently smoked cigarettes. Baseline clinical characteristics are shown in Table 2. The majority of participants were receiving ART (82%), of whom 71% had an undetectable HIV RNA with a median CD4 cell count of 364 cells/μL (IQR 230, 530 cells/μL). The median CD4 cell count of those not on ART was 373 cells/μL (IQR 259, 550 cells/μL). One hundred and thirteen participants Decitabine clinical trial (12%) were HCV RNA negative without having received prior treatment for HCV, indicating spontaneous clearance of their infection. One hundred and fifty-eight (17%) had received treatment for HCV prior to cohort entry. Of the remaining 797 patients never treated for HCV, 102 (13%) initiated treatment during follow-up (6.6/100 person-years; 95% CI 5.3 to 7.9). Thus, 70% of the cohort had never received HCV treatment. Table 3 shows the incidence rates for health outcomes among participants

since enrolment in the cohort. The cumulative incidences of liver fibrosis, ESLD, AIDS and death are shown in Figure 2. None of the participants with ESLD underwent liver transplantation. Death rates in the cohort were much higher than overall Canadian population death rates at all ages; see Figure 3. The overall standardized mortality ratio was 17.08 (95% CI 12.83, 21.34); the estimates were 12.80 (95% CI 9.10, 16.50) for male patients and 28.74 (95% CI 14.66, 42.83) for female patients. Causes of death were: ESLD (n = 18; 29%), drug overdose (n = 15; 24%), cancer (n = 6; 10%), AIDS-defining illnesses (5%), and others (18%) including trauma, respiratory failure, bacterial infection and septic shock. The cause for the remaining 11 could not be determined.

“
“Adult neurogenesis in the subgranular zone of the hippocampus (SGZ) is enhanced by excess as well as mild neuronal excitation, such as chemoconvulsant-induced brief seizures. Because most studies of neurogenesis after seizures have focused on the SGZ, the threshold of neuronal excitation required to enhance neurogenesis in the subventricular zone (SVZ) is not clear. Therefore, we examined the responses of SVZ precursors to brief learn more generalized clonic seizures induced by a single administration of the chemoconvulsant pentylenetetrazole (PTZ). Cell cycle progression of precursors was analysed by systemic administration of thymidine analogues. We found that brief seizures immediately

resulted in cell cycle retardation in the SVZ. However, the same effect was not seen in the SGZ. This initial cell cycle retardation in the SVZ was followed by enhanced cell cycle re-entry after the first round of mitosis, leading to precursor pool expansion, but the cell cycle retardation and expansion of the precursor pool were transient. Cell cycle progression Galunisertib in the PTZ-treated group returned to normal after one cell cycle. The numbers of precursors in the SVZ and new neurons in the olfactory bulb, which are descendants of SVZ precursors, were not significantly different from

those in control mice more than 2 days after seizures. Because similar effects were observed Non-specific serine/threonine protein kinase following electroconvulsive seizures, these responses are likely to be general effects of brief seizures. These results suggest that neurogenesis in the SVZ is more tightly regulated and requires stronger stimuli to be modified than that in the SGZ. “
“Proprioceptive afferent (PA) information is integrated with signals from descending pathways, including the corticospinal tract (CST), by spinal interneurons in the dorsal horn and intermediate zone for controlling movements. PA spinal projections, and the reflexes that they evoke, develop prenatally. The CST projects to the spinal cord postnatally, and its connections are subsequently refined.

Consequently, the tract becomes effective in transmitting control signals from motor cortex to muscle. This suggests sequential development of PAs and the CST rather than co-development. In this study we determined if there was also late postnatal refinement of PA spinal connections, which would support PA–CST co-development. We examined changes in PA spinal connections at 4 weeks of age, when CST terminations are immature, at 8 weeks, after CST refinement, and at 11 weeks, when CST terminations are mature. We electrically stimulated PA afferents in the deep radial nerve. Evoked PA responses were small and not localized at 4 weeks. By 8 and 11 weeks, responses were substantially larger and maximal in laminae VI and dorsal VII.

Polyclonal antiserum against the M. oxyfera and NirS enzyme was raised by injecting rabbits with two synthetic peptides: peptide 1 (amino acid position 139–153: PPDKRPTKPEHNRDW) and peptide

2 (amino acid position 520–534: EKARIDDPRIITPTG). Prior to the immunization, an extra amino-terminal cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec, Belgium). For the M. oxyfera pMMO enzyme, two polyclonal antisera selleck kinase inhibitor targeting α-subunit (pMmoB) were raised. α-pMmoB1 was raised by injection of rabbits with two synthetic peptides: peptide 1 (amino acid position 257–271: QTGRMDTPELKPTTE) and peptide 2 (amino acid position 324–337: DPALFPDSRLKIKVE). Prior to the immunization, an extra amino-terminal PD0332991 cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec). α-pMmoB2 was generated from a heterologously expressed and purified fragment of pmoB in Escherichia coli as described previously (Harhangi et al., 2002), with the following modifications. Two primers were designed on the pmoB sequence; a forward primer on nucleotide position 790 (CCCGAACTGAAGCCCACGACAGAG) and a reverse primer on nucleotide position 1188 (GCCGCCGACCTCAACAATTTGTCTG). A stop codon

(TAA) was included in the reverse primer so as to express only an N-terminal His-tag. For directional cloning, restriction sites EcoRI and NotI were included in the forward primer and XhoI in the reverse primer. An additional nucleotide (T) was added between EcoRI and NotI so as to bring the sequence in frame. pET-30a(+) (Novagen, Germany) was used as the expression vector. Rosetta cells (Novagen) were used as the expression host. The heterologously expressed protein fragment (amino acid position 264–396) was purified using the HIS-Select® HF nickel affinity gel column (Sigma, The Netherlands) under denaturing conditions using the protocol Baricitinib provided by the manufacturer. The identity of the expressed protein fragment was verified by MALDI-TOF MS peptide mass fingerprinting of a tryptic digest of the purified

protein fragment (Harhangi et al., 2002). For each antiserum, two rabbits were immunized using a 3-month immunization protocol. The antisera from both rabbits were pooled and affinity-purified (Eurogentec). The affinity-purified antisera (α-NirS, α-pMmoB1 and α-pMmoB2) were used as the primary antisera in immunoblot analysis and immunogold localization as described later. Approximately 2 g of cells (wet weight) was taken from the M. oxyfera enrichment culture. The cells were washed three times with 20 mM phosphate buffer pH 8.0 and resuspended in a medium containing 20 mM sodium phosphate and 50 mM sodium pyrophosphate pH 8.0. Cells were broken by sonication. Cell debris was removed by centrifugation (6000 g, 15 min, 4 °C), and the supernatant was collected as whole-cell extract.

It displays high activity

against mosquito larvae and Culex and Anopheles genera are its major targets (Lacey, 2007). The Bin toxin has a selective mode of action that depends on successive steps comprising ingestion of crystals by the larvae; midgut processing of protoxin into toxin; and binding to specific receptors within the midgut epithelium. These in turn lead to cytopathological effects on midgut cells and other unknown events Antidiabetic Compound Library supplier that cause the death of larvae (Charles, 1987; de Melo et al., 2008). The protoxin is a heterodimer formed by the BinA (42 kDa) and BinB (51 kDa) subunits, which are proteolytically processed to generate the 39- and 43-kDa toxic fragments (Broadwell & Baumann, 1987; Nicolas et al., 1993). selleck chemicals llc The BinA and BinB proteins are related in sequence and, when aligned, display 25% identity and 40% similarity (Charles et al., 1996). They are not related to better described insecticidal proteins and, although crystallography studies have been performed (Smith et al., 2004), three-dimensional

structures or models based on similar proteins are not available to date. For its activity, the two subunits act in synergy, because neither BinA nor BinB individually displays larval toxicity, except BinA in high concentrations (Broadwell et al., 1990; Nicolas et al., 1993). Interaction between the subunits is essential to achieve full toxicity against larvae and the toxin seems to form oligomers (Charles et al., 1997; Smith et al., 2005). Because of the lack of structural data, the roles of individual subunits and/or functional domains have been investigated using different approaches through their action on Culex larvae. Generally, the BinB component is recognized as being responsible for receptor binding, while BinA seems to play a role in toxicity (Oei et al., 1990; Nicolas et al., 1993; Charles et al., 1997; Shanmugavelu et al., 1998; Elangovan et al., 2000).

Mutagenesis studies have identified amino acids from the ASK1 BinA that are critical for the interaction with BinB and for inducing mortality in target larvae (Elangovan et al., 2000; Promdonkoy et al., 2008). Other residues, such as the charged amino acids R97, E98 and E114, might play a proper role in toxicity and do not interfere with subunit interaction (Sanitt et al., 2008). Previous investigations have shown the BinB ability to recognize and bind to midgut receptors through its N-terminal region, while the C-terminal segment seems to contain regions responsible for binding to BinA (Clark & Baumann, 1990; Elangovan et al., 2000). The BinB confers specificity to the Bin toxin because it recognizes and binds to GPI-anchored midgut α-glucosidases, Cqm1 and Agm3, characterized as specific receptors in Culex quinquefasciatus and Anopheles gambiae larvae, respectively (Romão et al., 2006; Opota et al., 2008).

7 to −0.2 s. The reduction in ABA was stronger when viewing needle pricks compared with Q-tip touches (Figs 3B and 4). The pattern in ABA was not due to phase-locked responses to the onset of the video clip (see Supporting Information and Fig. S1 for a comparison of total and induced activity). In the next step of the analysis, the ABA modulations (10 Hz, −0.7 to −0.2 s) were examined in source space. The linear beamforming

analysis revealed an ABA increase in occipital areas, which was stronger for Q-tip trials compared with needle-prick trials (Fig. 5, left and middle panels). In Q-tip trials the ABA increase extended to parietal Antidiabetic Compound Library high throughput areas. Moreover, a slight reduction of ABA was found in needle-prick trials contralateral to the forthcoming stimulation site, including the cingulate cortex, as well as parietal and frontal areas. The cluster-based permutation test revealed significant differences between conditions for two clusters in the right PCC (i.e. contralateral to the forthcoming electrical stimulation) and right FG (Fig. 5, right panel). In both clusters the ABA was lower when participants viewed needle pricks compared with Q-tip touches. The mean activity within each of these clusters was computed for further correlation analyses.

As SB203580 datasheet previous studies on viewing painful stimulation have found modulations in the sensorimotor cortex (e.g. Whitmarsh & Jensen, 2011), we explored whether this area also showed an effect on ABA in the present study. To this end, we created virtual channels for the sensorimotor cortex and the significant source clusters in the PCC and FG (see Supporting Information and Fig. S2 for details). The correlation analysis between the ABA effect (i.e. needle minus Q-tip) in the PCC and FG and the effect

on PDR, SPN, and pain ratings did not reveal any significant correlations across participants. However, there was a trend towards significance for the correlation between ABA in the PCC and the PDR (r17 = −0.44, P = 0.071). Next, the relationships between ABA, PDR, SPN, and pain ratings were investigated at the single trial level (see ‘Materials and PAK5 methods’). This analysis revealed a positive relationship between ABA in the PCC and ABA in the FG (t17 =11.77, P < 0.0001; average correlation coefficient over subjects: r17 = 0.31). Furthermore, a small but significant negative relationship was found between ABA in the PCC and the PDR (t17 =−3.36, P = 0.0037; average correlation coefficient over subjects: r17 = −0.07). No other significant relationships were observed. This study examined the impact of viewing a needle pricking a hand that is perceived as one’s own on anticipatory oscillatory activity, PDR, and subjective stimulus ratings to painful and nonpainful electrical stimuli. Replicating the results of our previous study (Höfle et al.

, 2001). Again, transcriptional changes were linked with progressive C. albicans infection, with little change in renal cytokine gene expression after infection with an attenuated isolate (MacCallum, 2009).

In a recent study, Lionakis selleck compound et al. (2011) utilized the mouse intravenous model of systemic candidiasis to characterize immune cell populations in infected organs during disease progression. Neutrophils accumulated in all fungus-infected organs, but a delay in their appearance in the kidneys rendered these organs unprotected during the initial 24 h of infection (Lionakis et al., 2011). Further increases in neutrophils occurred in the kidneys as disease progressed, but in other organs, where fungal growth was controlled, neutrophil accumulation was controlled and macrophages became evident (Lionakis et al., 2011). The results of this study are a major step towards explaining the kidney specificity of progressive C. albicans infection in the mouse BYL719 in vivo model. Infection of knockout mouse strains has also contributed to our knowledge of host susceptibility to Candida infection. Complement was shown

to play an essential role in C. albicans and C. glabrata systemic infections through infection of C3-deficient mice (Tsoni et al., 2009). In addition, pattern recognition receptor knockout mice were critical in demonstrating the importance of dectin-1, TLR2 and TLR4 in the recognition either and control of systemic fungal infection (reviewed in Netea & Marodi, 2010). In another example, both tumour necrosis factor-α and interleukin-6 (IL-6) were shown to be critical for normal host responses during disseminated infection, using both the intravenous and the gastrointestinal infection models (reviewed in Mencacci et al., 1998). In contrast, some host genes are only required for normal host responses in one model, or the other, for example IL-12 is

important for the gastrointestinal model, but dispensable for the intravenous model (Ashman et al., 2011), and the opposite is true for B cell knockout mice (Wagner et al., 1996). Mouse strain background can be an important consideration when working with knockout mouse strains as different strains vary in their susceptibility to systemic Candida infection (Marquis et al., 1988; Ashman et al., 1993, 1996). These differences in the knockout mouse strain background, in combination with different fungal isolates, can lead to conflicting results for the roles of host genes in susceptibility to C. albicans infection, such as was found for TLR2 and dectin-1 (reviewed in Netea & Marodi, 2010). Despite increased understanding of how C. albicans infection progresses, the diagnosis of these infections remains difficult. In addition to other clinical tests, there remains a reliance on positive blood culture to confirm the diagnosis of systemic candidiasis; however, some patient blood samples remain culture negative.

The aim of this review was to comprehensively examine the published literature to chart the participation and beliefs of pharmacy professionals in GB in relation to CPD in a decade (2000–2010) that had seen a formal transition from CE to CPD requirements. Three specific questions guided our review: What has been the range of views expressed by pharmacy

selleck inhibitor professionals in relation to CPD? What has been the uptake of CPD in pharmacy? In what way could the potential barriers to CPD uptake jeopardise the use of CPD in revalidation? A comprehensive search of the published literature was conducted to identify all studies that had examined the uptake of, or attitudes towards, the CPD process across the different sectors of the pharmacy profession in GB from 2000 to 2010, to cover the decade during which CPD was formally introduced and integrated into pharmacy in GB. During September to December 2009 (with additional searches in August 2010 and February 2011) the following academic databases were searched for articles published between 2000 and 2010: Medline, Cumulative Index to Nursing and Allied Health Literature (CINAHL) and International Bibliography of the Social Sciences, Zetoc, British Education Index (BEI), Educational Resources Information Centre (ERIC), Australian selleck screening library Education

Index (AUEI) and the Cochrane Library. An extensive search of the pharmacy

specific literature was also conducted by searching the journals Pharmacy Practice, the Pharmaceutical Journal (PJ) and Pharmacy Education, to include where possible conference proceedings from Health Service Research and Pharmacy Practice (HSRPP), British Pharmaceutical Conference (BPC) and International Social Pharmacy Workshop (ISPW). In addition, the search engine GoogleScholar™ as well as the database of the National Electronic Library for Medicine (NELM) were used in an attempt to capture studies published online which were not at first identified by the more traditional means. The reference lists of all the important articles were scanned to check for other important studies that may have been missed via the database searches. A variety MRIP of search terms was constructed for use within the databases including pharmacy, pharmacist, education professional retraining, continuing pharmacy education, professional development, learning, reflect, continuing education, CPD, continuing professional development, professional portfolio pharmacy, work based learning and continuous professional development. These terms were combined suitably according to the database used. The details of the search strategies are outlined and attached as an Addendum to this article.

Such

conditions often include environmental niches with limiting essential metals such as iron, zinc, magnesium, and manganese. The ability of Listeria to sequester these metals undoubtedly plays a role in the pathogenic cycle and the process of infection. In the external environment, Vemurafenib Listeria utilizes siderophores produced by other bacteria that chelate iron with high affinity to sequester iron from the environment (Simon et al., 1995). In the human host, iron is largely unavailable because of the metal being tightly bound to a number of host proteins (e.g. ferritin and hemosiderin) and the pathogen must compete for iron bound to heme and other sources to cause infection (McLaughlin et al., 2011; Xiao et al., 2011). After iron, zinc is the most abundant transition metal in the human body (Outten & O’Halloran, 2001). It is necessary for almost all living organisms as it acts as both structural and catalytic selleck chemical cofactors in numerous enzymes and proteins (Patzer & Hantke, 1998).

However, high concentrations of zinc can be extremely toxic to the bacterial cell and so zinc homeostasis must be maintained through expression of uptake or efflux systems (Beard et al., 1997; Rensing et al., 1997). Under conditions of zinc starvation, bacterial cells can induce high-affinity zinc uptake systems. High-affinity transporters have been described in numerous bacteria, and probably the best characterized are the ZnuABC system in Escherichia coli and the ycdHI-yceA system in Bacillus subtilis (Patzer & Hantke, 1998; Gaballa et al., 2002). Both of these

systems are ABC transporters consisting of a periplasmic binding protein (encoded by znuA, ycdH), a membrane permease (znuB, yceA), and an ATPase (znuC, ycdI). For the most part, these high-affinity zinc uptake systems are under the control of the zinc uptake regulator, Zur (Gaballa & Helmann, 1998; Patzer & Hantke, 2000). In L. monocytogenes, a Zur-like protein (encoded by zurR) has been identified in an operon with two other genes, zurM and zurA, which form a putative high-affinity uptake system (Dalet et al., 1999). Aside from the initial dipyridamole identification of this operon, the physiological role of the regulator and the identification of the ZurR regulon are relatively unexplored. In the current study, we show that zurR is important for normal colony formation and cell size and for survival of toxic levels of zinc. A number of genes harboring a sequence similar to the B. subtilis ZurR binding site (the Zur box) were identified using a bioinformatic approach, and we demonstrate that a number of these putative transporters are regulated by ZurR in L. monocytogenes. Similar to other metalloregulators (Fur and PerR) (Rea et al., 2004), we show that ZurR plays an important role in the successful infection of the murine model. Bacterial strains and plasmids used in this study are listed in Table 1.

Proactive daily targeting of patients with an INR > 4 appeared to prevent a further increase in the INR. We are now working with our GP colleagues to share the learning. We are adopting a similar targeted approach for patients on gentamicin. 1. NPSA Alert NPSA/2007/18, www.npsa.nhs.uk/ 2. The “How to Guide” for Improving Medicines Management, High Alert Medication (Primary Care), www.1000livescampaign.wales.nhs.uk J. Walkers, M. Wilcock Royal Cornwall Hospitals NHS Trust, Truro, UK We sought to

assess the local implementation of the insulin passport for adults patients admitted to hospital. Approximately half of the 50 patients had a passport but only two (4%) had a fully completed passport. Implementation of this safety initiative has been poor. As a result of over 16 000 insulin-related incidents that included several deaths and serious harm between 2004 and 2009 the National Patient Safety Agency (NPSA) issued a “Rapid www.selleckchem.com/products/Bortezomib.html Response Report”, outlining recommendations on staff training, safe prescribing and administration. It then developed a plan to work with pharmacists, people with

diabetes and other groups on producing a patient information leaflet and an insulin passport for all adults treated with insulin aged over 18 years.1 The insulin passport is intended to help provide accurate identification of patients’; current insulin products and provide essential information across healthcare sectors. Following the NPSA alert, a multi-disciplinary IDO inhibitor group introduced the insulin passport into practice in our hospital in September 2011. This move was also mirrored across the health community, with involvement of GP’s, district nurses and community pharmacy. As a follow up to this implementation we undertook a survey of adult patients on insulin who were admitted into our teaching district general hospital (approximately 600 beds) between May – July 2013 with the aim of ascertaining if patients were aware of, and had, an up to date insulin passport. To be eligible

patients had to be an inpatient, prescribed insulin and over the age of 18 years. They were then verbally consented, prior to completing a survey comprising of a maximum of 7 Progesterone questions to determine their adherence and understanding of the insulin passport. Only those patients who had bought their insulin passports into hospital with them proceeded to the final questions, where the completeness of the insulin passport was examined. The determination of the level of completion of the passport was assessed by the member of the pharmacy team completing the survey. Ethics committee approval was not needed as this was deemed service evaluation. Fifty patients (19 (38%) male) were included in the audit. Age bands were:- <25 years = two (4%), 26–64 years = 19 (38%), 65–74 years = 14 (28%) and >75 years n = 15 (30%). Fourteen (28%) patients had type one diabetes, and 36 (72%) had type 2 diabetes and were prescribed insulin.